December 14, 2015

Let’s Talk Cancer

Let’s Talk Cancer is a free and accessible full-day symposium for Grade 11 & 12 high school students.

Hosted by Let’s Talk Science and the Canadian Cancer Society – Research Information Outreach Team (RIOT), Let’s Talk Cancer was established to facilitate knowledge transfer between academia and high school students regarding the field of cancer biology. We hope to improve attending student’s basic knowledge of cancer and the challenges of cancer research through interactive hands-on activities and seminars from world-renowned scientists.

See below for details about our sixth annual Let’s Talk Cancer symposium!
 


2021 EVENT DETAILS:

Let’s Talk Cancer is going virtual this year! That means we are opening the symposium up nationally across Canada!

Lets Talk Cancer will take place on the 22nd and 23rd of April 2021.

Registration for Let’s Talk Cancer is now Open! Please register your students here or send each student the link to register on their own.

 

Download the Let’s Talk Cancer 2021 Agenda here

 

 

Workbook: Please download the PDF version of the workbook here! Note that it will no open properly with Google Docs, so please download the PDF version. 

DNA sequence needed for Activity: 

>Normal DNA

ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAGAGAGTGGAGGATGCTTTTTATACATTGGTGAGAGAGATCCGACAATACAGATTGAAAAAAATCAGCAAAGAAGAAAAGACTCCTGGCTGTGTGAAAATTAAAAAATGCATTATAATGTAA

>Tumour DNA

ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGATGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAGAGAGTGGAGGATGCTTTTTATACATTGGTGAGAGAGATCCGACAATACAGATTGAAAAAAATCAGCAAAGAAGAAAAGACTCCTGGCTGTGTGAAAATTAAAAAATGCATTATAATGTAA



If you have any questions regarding Let’s Talk Cancer please contact lts.grad@utoronto.ca


2020 Event Sponsors: